In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. trigger = { root. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . Let's all help each other learn the modding side of things as we enjoy CK3! :) To get us started, here's a tip from the official FAQ: Will there be a documentation of all the available conditions, commands, scopes. or open the Game folder containing your mods. The MAb CK3 produced by COS-7 and 293T cells showed strong antibody. 0, generated via automated export from the game files. Use DNA String code to change selected character must installed Cheat Engine and download ck3_1. Crusader Kings. The log folder also contains lists of effects, triggers and scopes. Engage in courtly intrigue, dynastic struggles, and holy warfare in mediæval Europe, Africa, the Middle East, India, the steppes and Tibet. Note that there are two different things that the game calls "modifier". Localization refers to the text presented to the player in events, menus, decisions, UI, and any other string of text in any window in the game. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Is there a scope that targets all living characters? I was dumb and downloaded an update to a mod that adds new traits on an ongoing game. These are the color-coded direct scopes as of 1. EDIT: Figured it out. 4, generated via automated export from the game files. This article is timeless and should be accurate for any version of the game. 4. Covid happened wich greatly delayed RC, both CK2 and EU4 had quite a bunch of early DLCs but most of them were shorter in scope when compared to CK3's DLCs, some of those tagged as "expansions" like sunset invasion were a small event without much change to the overall game. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Report. This is why it's unclear whether the different behavior in CK3 is working as designed or an oversight. 18; 5; 3;. Use script_docs and dump_data_types console commands in the game to generate them. It would look like "c_163109 = { #put your script/event here}". 4. trigger = { root. Trigger scope: council owner character. Toggle signature. These are the color-coded direct scopes as of 1. Scope consistency checking: are you using culture effects on cultures and character effects on characters, etc. Kingdoms ruled by a King, and Empires ruled by an Emperor. Note: I am Twitch streamer and I love to rename of the in game characters after my viewers it kinda creates fun. You could make Brazil declare war on a random country by doing something like Hello, i am new to modding, and there is enough info on wiki about simple editing, effects and triggers. mel; showPdxExport; You can add this to your shelf using the following process:CK3 Wiki Active Wikis. From the rugged Manchurian frontier in the north to the western edges of Papua in the south, this mod provides an immersive and vast world for players. Centre of any proper Scandinavian Empire. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 10 Culture 4. You can also integrate this mod into your mod projects. CK3 modding: is there a way to save multiple characters under one scope? I've been working on a mod to add a negative opinion modifier to a recipient, the target being multiple spouses. This is the official compatibility patch between More Holding Graphics and Culture Expanded. } Saved scopes will stay saved within the current code chain. 9 County 4. Crusader Kings III is our newest generation of beloved medieval role-playing grand strategy game. But what if you don’t want to start a career reverse-engineering software? Well, if you happen to have the Windows 10 Steam version of CK3 1. CK3 Wiki Active Wikis. Trigger scope: council owner character. Instructions can be found in the post. Hi, I am having problem while running the code: qiime cutadapt trim-paired --i-demultiplexed-sequences demux. CK3 Wiki Active Wikis. . A promote returns a scope, i. This page was last edited on 18 October 2020, at 17:45. Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . then simply use the create_alliance effect/command with that saved scope as the target. Add a set_mother = target effect,. These are the color-coded direct scopes as of 1. I. These are the color-coded direct scopes as of 1. Contents 1 Uses 1. These are the color-coded direct scopes as of 1. 4. She learned much, becoming a dedicated student of his teachings, becoming closer with her teacher than her own father. Converter tries to alter the map as little as possible against vanilla. any_mercenary_band = { # This limits the scope to a mercenary company which has the title name "d_new_merc". 8. } Saved scopes will stay saved within the current code chain. Legacy Wikis. 4. mother = scope:other_character. Covid happened wich greatly delayed RC, both CK2 and EU4 had quite a bunch of early DLCs but most of them were shorter in scope when compared to CK3's DLCs, some of those tagged as "expansions" like sunset invasion were a small event without much change to the overall game. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . Age of Wonders 4 Empire of Sin Cities: Skylines 2 Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Hunter: The Reckoning Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3. Engage in courtly intrigue, dynastic struggles, and holy warfare in mediæval Europe, Africa, the Middle East, India, the steppes and Tibet. CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3The scope character fires the target character form teh council. 8. Decisions also automatically scope to the character taking the decision too, so scoping to scope:actor wouldn't be necessary even if that was the proper scope. The game was revealed at PDX Con 2019 in October, and released on September 1, 2020. 2 ActiveCouncilTask 4. 4, generated via automated export from the game files. Effects • Triggers • Modifiers • Scopes • Variables •. playing until 476 or so and converting to CK3 with a late antiquity/migration period mod (conveniently, WtWSMS is going to have a CK3 successor:. 4. the. Hi everyone, I am struggling to understand how CK3 uses event scopes, as I am too used to Ck2 and EU4. 0. What you'd want to do instead is scope to the spouse of root, which you do with root. After starting Maya, you go into Plug-in Manager, and activate pdx_exporter. That is, not a vassal of your vassal. These are the color-coded direct scopes as of 1. Let's all help each other learn the modding side of things as we enjoy CK3! :) To get us started, here's a tip from the official FAQ: Will there be a documentation of all the available conditions, commands, scopes. Je n'ai pas finit la traduction c'est pour ça que la traduction est en Alpha voir pré-Alpha. Default: no. Click on a date/time to view the file as it appeared at that time. E. trigger = { root. File history. CK3 and something like Bannerlord are kind of interchangeable. 2_code. 8 CombatSide 4. Welcome to the beginner's guide for Crusader Kings III, a grand strategy game where you lead your medieval dynasty through warfare, diplomacy and intrigue on a path to glory. mother = scope:other_character. Here's what you can expect in terms of scope, features and modes. Crusader Kings. CK3 Male DNA Travis Fimmel (Old versions with Fair Ladies&Lords) Comments. Crusader Kings III uses 3d models to represent objects in the game such as portraits, units and holdings, as well as map objects such as trees. Comparing games is like comparing someone approaching retirement and somebody who has just started to walk. Ask modding questions here. 4, generated via automated export from the game files. 0, generated via automated export from the game files. For more utilitarian scripted triggers that need to be used across multiple files, the old folder system still works. 4, generated via automated export from the game files. List of every modifier that can be used in scripted modifiers and lists what types they can be used in. character_event; letter_event; duel_event; none (when an event doesn't use the root. These are the color-coded direct scopes as of 1. Is there a file somewhere, that lists all scopes, maybe? I digged around for 2-3 hours, but didn't find. Source: event_targets. The trick is to first save the character you want to ally with as a saved scope variable. These are the color-coded direct scopes as of 1. Engage in courtly intrigue, dynastic struggles, and holy warfare in mediæval Europe, Africa, the Middle East, India, the steppes and Tibet. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . mother = scope:other_character. 3 Activity 4. CK2 Cultures Reborn, a CK3 mod (OUTDATED) Do you miss Arberian, Carantanian, Coptic, Crimean Gothic, and Dalmatian from CK2? You can now find them. It is the sequel to Crusader Kings II which was released in 2012 and received content expansions until 2018 and then went free-to-play for the base game. 0, generated via automated export from the game files. scope:recipient = {allowed_to_marry_same_sex_trigger = no sex_same_as = scope:secondary_actor}In the game I'm currently playing, I'm holding Skåne. Member the -= Paradox Game Converters =- Team. 4, generated via automated export from the game files. . And our new UI system is the most open we’ve had in terms of what custom UIs mods can add and edit, but one issue it had was letting you add brand new things entirely and keeping compatibility nicely. This will also work with all modded maps. Feature suggestions -. 21 ScriptedGui 4. } Saved scopes will stay saved within the current code chain. Being a busy and dedicated man, she lived amongst books until her father recruited a scholar to teach her. mother = scope:other_character. scope:recipient = {trigger_event = vassal_interaction. e. If you have any knowledge on these, please feel free to contribute and help the documentation grow! Reply. To reach the remaining four, click the small button with a plus on it above the larger Realms mode icon. CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3For example, if you wanted to give whoever holds the county of roma a modifier, you could run this: effect = {title:c_roma = { holder = { add_character_modifier = governance_building_lessons_learned_modifier } } } If you want to apply it to yourself, the default scope is the character, so you could ignore all the title/holder stuff, like so. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . 0. trigger = { root. 4. A character refers to any person, historical or generated, that is represented personally in Crusader Kings III. } Saved scopes will stay saved within the current code chain. . These are the color-coded direct scopes as of 1. It is opposed to static history modding, though some scripts may exceptionally be triggered from history files. It's now standing on its own two feet and will grow. Jump to latest Follow Reply. the target of the effects saved_scopes = {} # any additional targets confirm_title. . These are the color-coded direct scopes as of 1. Keep in mind that. These are the color-coded direct scopes as of 1. trigger = { root. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . CK3 Wiki Active Wikis. Let's all help each other learn the modding side of things as we enjoy CK3! :) To get us started, here's a tip from the official FAQ: Will there be a documentation of all the available conditions, commands, scopes. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . 4, generated via automated export from the game files. These are the color-coded direct scopes as of 1. (Progress is in 0. cpp:276]: Script system error! Error: rarity trigger [ Wrong scope for trigger: none, expected artifact ] Script location: file: common/scripted_effects; add_scaled_artifact_modifier_grandeur_small_effect line: 11- CK3 Mod Co-op Co-Owner-Lead Developer on CK3 A Game Of Thrones, Kingdom of Heaven, Catholic Trinity, Dynamic Crusader States - Developer on the Expanded Mod Series. 3. Enter part of the name to find the character whose house you want to change. 1) of the game. Is there any mod to make armies spawn as one again or is there any way to turn it off in game?AEP: Beta 0. Scopes are used in scripting to select entities in order to check for conditions or apply commands. Learn More Submit Now About . CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . I suggest to make it a new, bigger role in CK3 - Executioner, a minor title that makes a certain character in charge of executions that you order. 4, generated via automated export from the game files. But I am unable to get the game to notice the biography_subject scope. CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3Modding quick questions and answers! Ask modding questions here. 4, generated via automated export from the game files. 4. Fixed a number of duplicate and missing localisations in various languages. The problem is that there is no documentation on what is available to the user, which of course if fine if there is some way to learn this by yourself. log for most game versions since launch. mother = scope:other_character. You can also integrate this mod into your mod projects. 11 bookmarkCK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . com] EPE Female DNA 01 DNA String: Persistent DNA: EPE. Use GitHub file history feature to compare_versions. Introducing CK3 #01 - Characters. Like @Karlington said above, there is no one right answer for child education in CK3. Lead developer on: CK3 to EU4, CK2 to EU4, EU4 to Vic3, EU4 to Vic2, Responsible Blobbing, Responsible Warfare (Victoria 2/3 Clamp Mods for EU4) See our other active converters: Vic2 To HoI4, Vic3 To HoI4, Imp to CK3, Imp to CK2 and more!As for CK3 map modes, there are a total of 11 to choose from. } Saved scopes will stay saved within the current code chain. Member the -= Paradox Game Converters =- TeamCK3 Modding #1 -Brief introduction to modding. mother = scope:other_character. 0, generated via automated export from the game files. Scripting is event-based, with Clausewitz engine being optimized to filter and process massive amounts of events on characters and provinces. Eventually, she even converted to his far away faith even. 5 Secret Modifiers are applied to different scopes. Jump to navigation Jump to search. Contents 1 Uses 1. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . log: List of valid inputs for most game versions since launch. It differs from static history modding, though some scripts may exceptionally be triggered from history files. 0, generated via automated export from the game files. . trigger = { root. Being a busy and dedicated man, she lived amongst books until her father recruited a scholar to teach her. At least some were last verified for version 1. It could be torture, release. It works with random scopes. 8. Corrected the modifiers of the Cup of Jamshid. 4. 4, generated via automated export from the game files. CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3CK3 Wiki Active Wikis. Don't get me wrong I know living to your 70s and 80s wasn't unheard of back in the middle ages, but it's way too common in CK3, for instance average lifespan was 31 in medieval England, I know child mortality contributed to that statistic but I'll get to that later. Realm bonuses include bonuses to men-at-arms and. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . Let's all help each other learn the modding side of things as we enjoy CK3! :) To get us started, here's a tip from the official FAQ: Will there be a documentation of all the available conditions, commands, scopes. Click the character's name/tag under the "Key" column. It works with random scopes. 8. ? History (for CK3): Are spouses, employers, and lieges alive on the relevant dates? Is no one their own grandfather? Special: rivers. These traits are temporary, and they go away once a child becomes an adult. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Converter tries to alter the map as little as possible against vanilla. Legacy Wikis. 0. trigger = { root. Le mod est une alpha d'une traduction française du mod "CK3 A Game of Thrones" il va vous faciliter votre compréhension du gameplay pour mes amis qui ne sont pas anglais(et oui j'ai pensé a vous mes amis francophones). This article is timeless and should be accurate for any version of the game. . use. My top 16 mods that i like to always run for a better crusader kings 3 experience, there mods dont massively change the core experience of ck3 while giving y. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Is there an alternative? Location. 5 Artifact 4. . 17 Province 4. trigger = { root. 0. 0. 4 Army 4. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . 22 Title 4. 49. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . joined_faction. 8. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Since the 1. Real strategy requires cunning. 0, generated via automated export from the game files. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. trigger = { root. 14 Faction 4. 2. This should solve empires sticking around forever as micro-realms. mother = scope:other_character. CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3The scope character fires the target character form teh council. This article is timeless and should be accurate for any version of the game. Governorship Scope - These are to Regions what States are to Areas; dynamically generated and based on what a country holds in a Region. However, the wiki doesn't explain how to use it. These are the color-coded direct scopes as of 1. Let's all help each other learn the modding. However, because CK3 map is special, you need to "degrade" it first using mapDegrader:. heal – This command will heal you and any nearby. However, because CK3 map is special, you need to "degrade" it first using mapDegrader:. CK2 has the respect of its long life, its triumphs and failures. 8 CombatSide 4. CK3 triggers, modifiers, effects, event scopes, event targets, on actions, code revisions and setup. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. qza --p-cores 16 --p-adapter-f AAGCTCGTAGTTGAATTTCG --p-adapter-r CCCAACTATCCCTATTAATCAT -. These are the color-coded direct scopes as of 1. 3D models. You are encouraged to expand upon this and make your own set tailored to your mod's needs. The trick is to first save the character you want to ally with as a saved scope variable. In theory, in ck3 since there are not ppl with 150 different personality traits like in ck2, it should be easier to make NPC characters act their personality traits way. Every single character is an individual, living entity that will act. 0, generated via automated export from the game files. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . 4. Army spawning. mother = scope:other_character. Each file can hold as many events as one would like. Ask modding questions here. CK3 is set in a time that's not very accommodating to LGBT people. However we will only move within our scope of 2E 440 to 2E 896. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. These are the color-coded direct scopes as of 1. . net and assigning them to in-game cultures. 10 Culture 4. event_scopes. But its what we knew and came to love. If on linux, install libcurl3. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Age of Wonders 4 Empire of Sin Cities: Skylines 2 Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Hunter: The Reckoning Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3. So it ends up like this: create_alliance = scope:name_of_your_saved_scope. Crusader Kings is a historical grand strategy / RPG game series for PC, Mac, Linux, PlayStation 5 & Xbox Series X|S developed & published by Paradox Development Studio. So my ck3 when I play and It crashes and i have these errors: [20:13:44][jomini_script_system. 4. The core [`Scopes`] type which tracks our knowledge about the types of in-game values. 4. First download and install Meld as it will make re-exporting a little more painless. 8. A_Knight74 • 3 yr. Party Scope - Parties are political entities in Republics in the game. 4. Engage in courtly intrigue, dynastic struggles, and holy warfare in mediæval Europe, Africa, the Middle East, India, the steppes and Tibet. 0 See event_targets. Recipient is above a baron (At least a count)CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . 0 unless otherwise noted. x. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. - northern stories is pretty much 3 traditions in 1 made only for norse. then simply use the create_alliance effect/command with that saved scope as the target. As for scope:recipient, that one is probably empty. There is also the fourth and most advanced member of the family, PREV, which you didn't mention. 4. Introducing CK3 #01 - Characters. 4 Types 4. Are you a fan of Crusader Kings III, the grand strategy game that lets you shape the medieval world? Do you want to learn more about the game's effects, the commands that change the game state in various ways? Then check out this webpage, where you can find a comprehensive list of effects for the game version 1. These are the color-coded direct scopes as of 1. 4. To open the exporter, run the following MEL script: rehash; source pdx_export_ui. 3 Activity 4. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. {"payload":{"allShortcutsEnabled":false,"fileTree":{"":{"items":[{"name":"compare_versions","path":"compare_versions","contentType":"directory"},{"name":"1. Global commands can be used anywhere, like GetPlayer (returns the player character) or GetCurrentDate. mother = scope:other_character. in the dev diary they said that byzantine improvements wouldn't be in a flavor pack as the scope the believe is necessary is too large for a flavor so they said it would likely be included as a part in a. What should I need to wrote in the console in order to succeed. Putting a condition check inside an effect block will be flagged up as incorrect, as will trying to check if a scheme scope = root when root is a character. 0, generated via automated export from the game files. Scopes. It combines refined poetry, storytellers and runestone raisers in to one tradition. CK3 Modding #1 -Brief introduction to modding. Thank you all for your help!CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . An empty trigger is treated as 'no'. 2 On_actions from code 12. Type "explorer" to get the explorer window up. . Content is available under Attribution-ShareAlike 3. 4, generated via automated export from the game files. The supported target is the value that can be passed to it. The events directory may also have sub. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . 8. cpp:276]: Script system error! Error: rarity trigger [ Wrong scope for trigger: none, expected artifact ] Script location: file: common/scripted_effects; add_scaled_artifact_modifier_grandeur_small_effect line: 11- CK3 Mod Co-op Co-Owner-Lead Developer on CK3 A Game Of Thrones, Kingdom of Heaven, Catholic Trinity, Dynamic Crusader States - Developer on the Expanded Mod Series. 3 Dynasty house 2. The wrapping scope should be the dynastic spouse in same sex couples. These can be found in the effects/triggers section of the wiki. Added a Game Rule (Empire Obscurity) that makes empires that control below 20% of their De Jure counties be destroyed.